[ [ < ] [ b / g / s / v ] [ Kurallar / Stats ] ]

/b/ - Rastgele

Name
Email
Subject
Comment
File
:
Password (For file deletion.)

File: 1618969827779.jpg (4.49 MB, 6700x4650, 134:93, bokistan3.jpg) ImgOps Google

3f30d No.123534[Last 50 Posts]

Tek tiradda toplayalım dağılmasın.

029f6 No.123535

File: 1618970371079.jpg (2.78 MB, 6700x4650, 134:93, bokistan (2).jpg) ImgOps Google

güzel ama eksik

8594c No.123547

File: 1618990914115.jpeg (225.38 KB, 1439x943, 1439:943, received_337215706923084.jpeg) ImgOps Google

dün gece ben açacaktım sen benim yerime açmışsın eyw op

3f30d No.123554

File: 1618992531676.png (44.62 KB, 590x378, 295:189, ClipboardImage.png) ImgOps Google

şu tezekistan topluluklarının içinde yamtarlar kadar cringe olan başka bir güruh var mıdır? adamların tek yaptığı bokistanın gerçeklerine kulak tıkayıp sırf bokistan halkını yüceltmek hatta dünyanın en üstün ırkı zannetmek. bir de balkanlı mutt osmanlı'nın ve devşirme ordusunun yaptığı savaşlarla övünmeleri ve moğol LARP'ı yapmaları yok mu kek. kendi çorap kokan görüşlerine katılmayanlar için de hemen "yoo sen türk değilsin yoo sen malum ırksın yoo sen türklüğe layıq değilsin t*rklük bir onurdur hurr durr" diye sıçmıklarını yayarlar ortalığa. ben t*rkoların arasında bu kadar delüzyonel ve paranoyak bir güruh görmedim. o mide bulandırıcı bilimum moğol LARP'ı, "t*rke karşı gelmek tengriye karşı gelmektir" kalibresindeki cringeliklerine hiç mi hiç değinmeyeceğim, her gördüğümde cringe paçalarımdan akıyor. işin ilginci sanal ortamda gördüğüm yamtarların yarısına yakını yurtdışında yaşayan gurbetçi. tece denilen cehennemde yaşamadıkları için mi t*rk toplumunu bir bok sanıyorlar yoksa orada gördükleri çingene muamelesi yüzünden bir savunma refleksi mi oluşturuyorlar bilmiyorum. ama dünyada dengi pakistanlı, hindistanlı ve bangladeşli olan bir topluluğun aynı anda kendisini hem avrupalı hem orta asyalı hem akdenizli zannetmesi gerçekten hayret verici. ortadoğulu olduklarını bir türlü kabullenemiyorlar. iki kıtanın arasında sıkışıp kalmış, ne idüğü belirsiz, tezek kokan bir halkın ırkçılığını yapmak da tam bu embesillere yakışır.

813a8 No.123556

>>123554
türkler gayet orjinal bir tarihe ve kültüre sahip bir millettir. bunu ben değil bütün viktorya dönemi yazarlar söylüyor, montesquieu söylüyor. avrupalı osmanlıyı yalamak için oryantalizm kültünü oluşturmuştur. he bangladeş ortadoğu falan.

28671 No.123559

File: 1618995204662.mp4 (1.53 MB, 960x540, 16:9, F5Pdk6P.mp4) ImgOps Google

tek tiradda toplayınca da tiradı gizleyip devekuşluğu yapıyorlar anon

31e7a No.123560

>>123556
türklerin medeniyete bi katkısını söyle o zaman

e97f9 No.123563

File: 1618996488233.jpeg (45.72 KB, 374x820, 187:410, Eq6PLycXUAAIEeg.jpeg) ImgOps Google


3f30d No.123566

File: 1618997229469.jpeg (67.67 KB, 640x480, 4:3, turksubhumans.jpeg) ImgOps Google

>>123556
>türkler gayet orjinal bir tarihe ve kültüre sahip bir millettir.
>avrupalı osmanlıyı yalamak için oryantalizm kültünü oluşturmuştur.

bu bahsettiğin kesim osmanlı'nın yönetici elit kesimiydi ve bokistan halkıyla hiçbir zaman HİÇBİR alakaları olmadı. zaten hepsi kamal tarafından teceden siktir edildikleri için o sofistike kültürleri de beraberlerinde yok olup gitti. bokistan halkı osmanlı'nın mirasçısı falan da değildir. hiçbir zaman olmadı. balkanların kaybedilmesi ile imparatorluğun 500 senedir suratına bile bakmadığı bok kokan anadoluya dikkat buyruldu ve imparatorluktaki bütün müsloların anadoluya toplatılıp yeni "türk" milleti yaratma projesi tasarlandı. bunun sonucu da bugün gördüğün ne idüğü belirsiz halktır.

3f30d No.123577

File: 1619004710227.png (6.16 MB, 1800x1376, 225:172, mike.png) ImgOps Google

varsın türk milleti hâlâ daha osmanlı'da yaşasaydı. varsın c*mhuriyet denilen low IQ her tarafı tezek kokan başarısız projenin tecavüzüne uğramasaydı. ordunun öncülük ettiği, habire bir darbe yapmayı kendine hak gören ekonomisinden tut devlet dairesine kadar hiçbir sikimi işlemeyen, her boka ama her boka köstek olan bu kokuşmuş kamalist rejime aşık olmasaydı. dindar ahlaklı ama aynı zamanda gelişmiş ve kaliteli bir toplum olsaydı. avrupa ve asyayı bağlayan, ortadoğu'nun incisi, tam bir ekonomik ve kültürel bir powerhouse olsaydı. ama insan sadece keşke diyebiliyor işte. osmanlı olmasa bile ingiliz mandası altına girip bir hong kong bir singapur gibi olabilirdik bile hatta. k*mal dışında her şey olabilirdi. v*tan toprağı hakkari van erzurum boyu kürdolara ve ermenilere izmir de yunanlara kaybedilirdi ama gram umrumda değil. ama gel de bunu 600 senelik muhteşem bir kültürü ve mirası sikip atıp, dilin amına koyup alfabeyi komple değiştirip türk dilinin 1000 yıllık korpus'unu, yazı geleneğini ve yazı dağarcığını çöpe atıp bütün potansiyelin amına koyup sıçmıkistan güzellemesi yapan kamalcı yamtarlara anlat. gavatlardan tüm benliğimle nefret ediyorum.

dbadc No.123580

>>123577
>dindar
>gelişmiş
Birini seç

23f48 No.123581

File: 1619007090059.jpg (47.43 KB, 626x398, 313:199, 59c721d145d2a027e83a52d2.jpg) ImgOps Google

>>123577
>600 senelik muhteşem bir kültürü ve mirası

stalin ayetel kürsü okuyup almanları yendi diyen fesli deliden tarih öğrenince böyle fikirler oluşuyor.

b54ed No.123582

>>123566
>>123577
Aradığın duyguların tercümesini Nazım'ın bu şiirinde bul, Türk'lüğe dil uzatma. Azcık erkek olsan bu şiirin benzerini yaz da görelim. Darbukatör ezik.

Sekiz Yüz Elli Yedi

İslam’ın beklediği en şerefli gündür bu
Rum Konstantiniyye’si oldu Türk İstanbul’u

Cihana karşı koyan bir ordunun sahibi
Türk’ün genç padişahı, bir gök yarılır gibi

Girdi Eğrikapı’dan kır atının üstünde
Fethetti İstanbul’u sekiz hafta üç günde

O ne mutlu, mübarek bir kuluymuş Allah’ın!
Belde-i Tayyibe’yi fetheden padişahın,

Hak yerine getirdi en büyük niyazını
Kıldı Ayasofya’da ikindi namazını!

İşte o günden beri Türkün malı İstanbul,
Başkasının olursa, yıkılmalı İstanbul!

Nazım Hikmet

3f30d No.123584

File: 1619008291423.jpg (482.94 KB, 1326x860, 663:430, kamalist.jpg) ImgOps Google

>>123581
>argümanım yok
>fesli deli
>hemen osmanlı ile herhangi bir anlamda alakası olmayan tarikatçıların crowd picture'larını atayım
ortalama t*rk gibi mavihaplı ve low IQ'sun. *kşideki irtica irtica diye diye kafayı bunamış gavatların tekrarladığı sıçmıkları gelip önümüze sunuyorsun.

>fesli deliden tarih öğrenince böyle fikirler oluşuyor.

ÜKM zamanında gerçekleri teker teker açıkladığından olsa gerek rahmetli mezardan hâlâ daha kamalcıları kudurtuyor kek. :DD tarihi tarihçilerden değil de senin gibi 89 IQ'lu NPC'ler gibi ortaokul-lise inkilap ve atat*rkçülük dersinden mi öğrenelim koççum?

>>123582
m*rat pls go :DD

b54ed No.123587

>>123584
tarihimiz kaybolmuş değil, sanki osmanlı zamanında millet okuma biliyordu da her yerde arapça neşriyat vardı sanrısına kapılmışsın.

9f21b No.123588

>asgari ücret rusyanın altında
>en boktan çin malı telefon 2 bin bokistan dinarı
>en boktan bilgisayar 4 bin bokistan dinarı
>bisiklet çarpsa ikiye ayrılacak "otomobil"ler 100 bin bokistan dinarı
>elektrik faturası geçen yılın iki katı
>her gıda ürününün kalitesi ve gramajı daha düşük buna rağmen fiyatı iki kat daha yüksek
okuduğum iktisatçılar, köşe yazarları hala daha kötüye gideceğini söylüyor. bokistan bokunda boğuluyor.

23f48 No.123589

File: 1619009617406.png (925.38 KB, 980x550, 98:55, kadir-mısırlıoglu.png) ImgOps Google

>>123584
evet, deli değildi.

251a3 No.123590

2008'e kadar ne oldu dolar düştü? ve 2008'den sonra ne oldu da dolar çıkmaya başladı?

30f4c No.123591

>>123590
Bu eniklere sorsak ehonomi çoh eyiydi o yıllarda o yüzden. Halbuki işsizlik sefalet aynı olduğu gibi duruyodu, sadece amarka'nın sevdiği insanlar fethullahçılar falan filan yüksek yerlere gelmişti amerika'da ne istese yapabiliyodu. Kozmik oda vs. O yüzden ilişkiler yatırımlar fena değildi dolar da düşüktü.

Ha siz ben ucuza iphone aliyim playstation aliyim tek fethullah ve amerika yine güçlensin diyosanız haksızsınız diyemem. Ama çıkıp bi liberalin fethullahın çatır çatır adam harcadığı yıllara: "o yıllarda en azından hak hukuk vardı" demesine ifrit oluyorum.

251a3 No.123592

>>123591
o yıllarda et döner 2.5 liraydı ve pahalı derdik yiyemezdik.

2a887 No.123593

>>123592
Et dönerin 2.5 lira olduğu yıllarda (ki o gıda boyalı kuyruk yağına et dersek) asgari ücret ne kadardı peki? Bu ülkede ekonomi hiçbir zaman iyi olmadı ve olmayacak bunu öğrenin artık. Yapılacak tek şey batıyla ilişkileri güçlendirip en azından npc orta hallilere azcık refah göstermek. Yani ben ülkenin başkanı olsam öyle yaparım.

Ayrıca bokistan'dan gidecem hacumculara da tavsiyem gitmeyin. Götü boklu türko dişisi bile kahve içme teklifinizi reddetti diye 300 post tirat döşeyen hassas götlü adamlarsınız, batının o kibirli ırkçıları sizi çubuk kraker gibi yer amına koyim. İzmir'in, Çanakkale'nin sakin, çomar free beldelerine gidin daha iyi.

251a3 No.123594

>>123593
asgari ücret ne kadardı 500 filan. alamıyorduk işte. şimdi et döner 15 lira. yine aynı miktarda alabiliyoruz bir şey değişmedi.

8b8a3 No.123595

File: 1619014728730.png (128.96 KB, 966x978, 161:163, rRRHVYG.png) ImgOps Google

S U Ç L U S U =

>k*rtler

>ar*plar
>ing*lizler
>fr*nsızlar
>anadoluya kuzeyden değil güneyden gelen atalarım
>genomundaki x91mw2m12 lokasyonundaki dizilim TAGTAGTAGGATGAGTGAGTAGAGCTAGCTAGCGCATGCATGCATCGATCG olan yani ar*plık olan akp seçmeni

c9e48 No.123597

bugün borsa bir ara yüzde dört eksideydi. daha önce de böyle düşüşler oldu ama erdoğan'a bu kadar çok eleştiri geldiği görmemiştim forumlarda

9f21b No.123601

File: 1619016293735.png (272.89 KB, 533x655, 533:655, ClipboardImage.png) ImgOps Google

>>123595
ülkeye giren her ürün 2 katı yerine 8 katı daha pahalıya giriyor buna karşılık aldığın maaş yerinde saymış hatta düşmüş. sen nasıl alım gücünün düşmediğini iddia ediyorsun?

9f21b No.123602

>>123601
bunaydı >>123594

>>123595
yıllar önce toruda bir anket yapıldı bu ülkedeki en büyük problem hangi etnik kimlik diye türkler ilk sırada çıkınca götüm yanmıştı. şimdi gerçeği görüyorum.

3e2f9 No.123603

File: 1619017009675.png (166.51 KB, 666x375, 222:125, eeee.png) ImgOps Google

>>123602
anket basi 20 lira alan universite ogrencilerinin eline tutusturacagin yanli sorularla istedigin sonucu alabilirsin istedigin yerden. istatistik cok guzel bir bilim.

c2d7d No.123604

File: 1619018150200.mp4 (4.36 MB, 640x640, 1:1, 22.mp4) ImgOps Google


c9e48 No.123605

>>123604
yaramı deşti bu çocuk. kpss'den 91 mi 94 mü ne aldım. ama meslek lisesi mezunu olmadığım için hiçbir yere başvuramadım. 2-3 büro memuru alan yere başvurdum onlar da olmadı. olmayınca tüm umudumu çöpe attım

813a8 No.123692

>>123566
balkanlar şanlı anadolulu tarafından fethedilmiş topraklardır. çocukları köle olarak alınmış ve anadolulu aileler tarafından anadolulu olarak yetiştirilmiştir. viktorya dönemi yazarların erim erim yandığı TAM olarak anadoluludur. bugün antalya'nın pattaya olma potansiyeli varsa, ülke avrupalı karıların sex turizmi lokasyonuysa bunun sebebi anadoluludur.

92ded No.123698

Sevgili anonlar,
"Keşke şöyle olsaydı keşke böyle olsaydı, arapların amına çakayım ah onlar olmasaydı." demek bizi hiçbir yere götürmez. Bu sorunlara başkaları sebep oldu diyerek ağlamak yerine birlikte çözümler üretmeye çalışıp hep birlikte aydınlık bir geleceğe yürümeliyiz. "Ne diyor bu delüzyonel piç?" diyorsanız da kendinizi kurtarmak için bir şeyler yapmalısınız. İlk adım olarak şu soktumun tahtasına veya çanına girmeyi bırakabilirsiniz.

0c626 No.123704

>>123698
>İlk adım olarak şu soktumun tahtasına veya çanına girmeyi bırakabilirsiniz.

https://www.youtube.com/watch?v=lITBGjNEp08

90b31 No.123736

>>123605
E bizim bakir de kpssden 91 puan alıp meslek lisesi mezunu olmadığı için sadece birkaç yere başvuru yapmış onlara da alınmamıştı ama o anlattığında dalga geçiyordunuz.

Tvde evden kaçan çocukları ile ailelerin buluşmasını izleyip ailesi de ilgilenmiyor ki çocuk evden kaçmış diye çocuğa üzülen ama evdeki kendi çocuğuna da eleştirdiği şekilde davranan ebeveynlerden farkınız yok.

babam da zamanında anama çok çektirdi şiddet de uyguladı şimdi haberde kadına şiddet haberleri görünce kendi yapmamış gibi asmak lazım böylelerini birini asın bakalım bir daha böyle hadiseler yaşanacak mı diyor içimden bi siktir çekiyorum.

08a8a No.123738

>>123736
vovovovo. bakirin durumundan haberim bile yok. hıh

08a8a No.123739

>>123738
o değil de bakire çok benziyorum. lokasyon, yaş, ten rengi, karşı cinsle münasebet, kpss puanı. eman tanrım

f0d1b No.124398

File: 1619473346437.png (81.14 KB, 200x200, 1:1, ClipboardImage.png) ImgOps Google

>internet kopuyor eşşek yükü para veriyorsun hızı sik gibi
>rüzgar esse yıkılan, apartman boşluğunda yemek kokusu çocuk ciyaklaması sesi olan, yan komşunun gece dörtte ankara havası açan eşek tırrık olduğu betonundan çalınmış tesisatı sorunlu "ev" 500 milyar
>günde 5 kere avaz avaz imam bağırıyor
>asgari ücretle iş bulunmuyor arabalar 200 milyardan başlıyor
>sağlık güvencesi yok hastaneler çökmüş kanser olsan 16 ay sonraya randevu veriliyor buna rağmen haberin olmadan sağlık sigortası borcu faiziyle birikiyor, hastanelerde yatak yok diye sokağa atıyorlar yandaş televizyon amerika'da sağlık sistemi çöktü diye haber yapıyor

b674c No.124399

File: 1619474585801.jpg (148.34 KB, 836x1000, 209:250, Medeleeff_by_repin.jpg) ImgOps Google

>>123534
aslında o kadar da kötü değil der gibi olduğum an şu tiradlara giriyorum brown pillenip çıkıyorum

ae108 No.124437

>>123534
Orrrrrospu çocuğu bokistan bir yemek yememi bile fazla gördü parasızlıktan sinirlerim bozuldu. İş yok para yok yapacak bir şeyim de yok. intihar edip kurtulam bari

d0491 No.124444

https://youtu.be/zsoVrZLubig
Bokistanlı contenti tüketilmez

fd3fe No.124445


b674c No.124458

>>123535
>>123547
>>123563
>>123581
>>123588
>>123589
>>123601
>>124398
>>124444
>>124445
Bu ülkenin insanından dininden milli dini değerinden bayramından kültüründen her ama her şeyinden bıktım usandım tiksindim artık. Keşke türkiyede doğmasaydım. Türk olduğum için kendimden utanmakla beraber tiksiniyorum. Şu topraklara 1 tek çivi çakarsam şerefsiz namussuz evladıyım

73910 No.124500

File: 1619540388772.jpg (29.33 KB, 643x363, 643:363, TEOMAN.jpg) ImgOps Google

belki bana salak, mal, aptal, gerizekalı vs. diyeceksiniz fakat, her ne kadar sikimistan nefretim en az sizler kadar büyük olsa da, ben burada kalıp son çomar ketlenene kadar mücadele etme taraftarıyım. yurtdışına gitme imkanım yok, olsaydı bile tüm samimiyetimle söylüyorum ki gitmek yerine bulunduğum yeri güzelleştirmek veya çabalarım boşa giderse çomar-free bir yere yerleşip izole bir hayat sürdürmek için harcardım.

f0d1b No.124529

File: 1619564426794-0.png (309.55 KB, 499x485, 499:485, ClipboardImage.png) ImgOps Google

File: 1619564426794-1.png (460.04 KB, 657x537, 219:179, ClipboardImage.png) ImgOps Google

File: 1619564426794-2.png (1.03 MB, 640x853, 640:853, ClipboardImage.png) ImgOps Google

File: 1619564426794-3.png (1.26 MB, 1080x2340, 6:13, ClipboardImage.png) ImgOps Google

>>124500
istesen de çıkamayacağın günler yaklaşıyor.

9e6ed No.124582

File: 1619615106995.png (77.24 KB, 300x300, 1:1, gigaosmanli.png) ImgOps Google

>>123577
İttihat ve Terakki olmasaydı günümüz:

>Devlet-i Aliyye-i Osmaniyye

>İng: The Exalted state (Kısaca Ottoman Empire ya da TES)
>Yıl 2019
>Monark: Kayzer-î Rum
>Yönetim şekli: Meşrut-î Monarşi
>İktidar parti: Fırka-î Ahrar (Liberal parti)
>Legislature: Meclis-î Nev-î Mebûsan
>Anayasa: Kanun-î Esas-î
>Resmi Din: Religious pluralism
>Başkent: Konstantiniyye (Nam-ı diğer: Istanbul, Konstantinopolis, Yeniroma, Nova Roma)
>Nüfus: 45,213,859 (40% Türkmen, 30% Helen, 10% Ermeni, 10% Bulgar+Pomak, 5% Tatar, 5% Çerkez)
>Doğu ve İç anadolu yok
>Balkanlar hâlâ elde
>En gelişmiş Vilayetler sırayla: Istanbul Vilayeti, Selânik Vilayeti, Edirne Vilayeti, Hüdavendigar Vilayeti, Aydın Vilayeti
>Resmi dil: Lisan-ı Osman-î
>Yaygın diller: Türkçe, Yunanca, vs.
>Currency: Para ve Yeni Akçe
>GDP: 68 bin dolar
>Asgari ücret: 1500 dolar
>1 Osmanlı Yeni Akçesi = 2.87 dolar
>HDI: >0.9
>Ortadoğu ve Balkanlar'ın yegane Kültürel ve Ekonomik powerhouse'su
>Minarşist Devlet
>Resmi tatiller: 29 Mayıs, 21 Nisan, 26 Ağustos
>mfw

9e6ed No.124588

File: 1619617380898.jpg (304.89 KB, 1519x808, 1519:808, bokistan serzenişi no bilm….jpg) ImgOps Google

>>124582
Snap back to reality:

>Dürrükiye """"cumhuriyeti"""" (ülkeyi diktatör kurmuş, her 10 sene darbe oluyor)

>İng: Hindi (kek)
>Yıl 2021
>498257194234: tezekistan diktatörü: tayyar
>Yönetim şekli: Askeri Despotizm
>İktidar parti: Makarna kömür partisi
Muhalefet: c*hape + PKK partisi
>Legislature: TBMM denilen hiçbir sikime yaramayan şer odağı
>Anayasa: 82 anayasası (bol bol 5816lı)
>Resmi Din: Kamalizm ve Yamtarlık (Nam-ı diğer: ""Laiklik"")
>Başkent: ank*ra (memur wasteland)
>Nüfus: 82 milyon (60% tırk, 20% KÜRD, 20% Suri boğa + afgan buğa ve diğer üçüncü dünyalılar)
>Doğu ve İç anadolu nüfusun çoğunu oluşturuyor
>Balkanlardan geriye kalan tek şey götüboklu trakya ve istanbul kanalı + ARAB buğalara satılan tekirdağ arazileri
>En gelişmiş iller sırayla: Hakkari, Şırnak, Bayburt, Artvin
>Resmi dil: Yörüngeselözyönetimerksel gibi uyduruk kelimeler barındıran fakir dil
>Yaygın diller: İngilizce (kek), ARABi
>Currency: dürrük lirası
>GDP: 8 bin dolar
>Asgari ücret: 350 dolar (70% asgari ile çalışıyor)
>1 dırrık lirası = 0.12 dolar
>HDI: 0.6
>kıyaslayınca götüboklu romanyanın bile daha yaşanabilir olduğu bir cehennem
>her boka karışan devlet, HİÇBİR anlamda özgürlük yok, verginin vergisi alınıyor, hizmet de sıfır
>Resmi tatiller: 29 ekim, 23 nisan, 10 kasımda vasat diktatör için ayağa kalkmayanın kafasına sıkacağız ve bilimum yamtarlıklar
>mfw

6ef19 No.124591

Tirad açacaktım da baktım bokistan sikim tiradı varmış zaten. Neyse şunu diyecektim:

BUNDAN BİLMEM KAÇ SENE ÖNCE BOKİSTANIN KOZMİK ODASINA TARİKATÇİLER ELİNİ KOLUNU SALLAYARAK GİRİP 125 MİLYON SAYFALIK BELGEYİ TUTANAKSIZ BİR ŞEKİLDE KOPYALAYIP DIŞARI ÇIKARDILAR


KEK BE. aklıma geldikçe günüm yapılıyor. Literally ülkeye ait bütün sırlar ve planlar, aklınıza gelebilecek her türlü bilgi bir sahte ihbar üzerine yabancı ülkelere ve tarikatlere servis edildi :DDDD Bunun karşılığında ne kamalcılar, ne de ordudan bir allahın kulu parmağını kaldırabildi. Sikindirik suriye'de bile böyle bir şey olmamıştır. Irak işgal edilirken bile o belgeler sızmayıp ateşe verilmiştir. Tezekistan'da ise hiçbir efor sarf edilmeden seve seve verildi o belgeler :DDD

KEEEEEEEK

ab731 No.124594

>>124591

sadece kek

a2f54 No.124602

File: 1619627385551.mp4 (2.19 MB, 400x226, 200:113, eskigüzelgünler.mp4) ImgOps Google

>>124529
bu saatten sonra çıkıp çıkmamak sikimde değil zaten. ben bu memleketin en azından 90'lı yıllara, akp öncesi özgürlük yıllarına dönmesini arzuluyorum fakat asla o günlerin geri gelmeyeceğinin de artık farkındayım maalesef. sadece ortalama bir çomarın artık sokaklarda gerine gerine dolaşmak yerine korkarak dolaştığı günlerin hayalini kuruyorum.

c6ebc No.124658

>>124602
>Yamtar mahzeninden bildirdi

e5d88 No.124660

File: 1619647415942.mp4 (87.33 KB, 480x270, 16:9, lmao.mp4) ImgOps Google

>>124602
>eskigüzelgünler.mp4
>ben bu memleketin en azından 90'lı yıllara, akp öncesi özgürlük yıllarına dönmesini arzuluyorum
>t. 2000 doğumlu
Yahu anon banlanmak istemediğimden altyaş falan demiyorum da sahiden kaç yaşındasın be amına koyayım. Bokistanın boktanlığını sırf AKP'ye bağlaman yetmiyormuş gibi kamalcıları kurtarıcı olarak görmen ki asıl sorunun kaynağının betoncular olduğunu idrak et önce. Çomar avı falan bu ne be cringe paçalarımdan aktı resmen. Militarizm gibi sikik sokuk yamtar yüzkitabı sayfalarındaki ergen türkoların yaptığı ki tane sikindirik /pol/ çakması nazi rp'si videosu izleyip etkilendin diye hiç yaşamadığın dönemler hakkında atıp tutuyorsun.

94d17 No.124664

>>124602
Kek akpnin en az darbeciler kadar kamalist olduğunu idrak edememişsiniz.
Sorun çomarlarda değil kemalizm hastalığı sorun

2c80b No.124675

File: 1619655743995-0.png (474.45 KB, 520x520, 1:1, neslişah sultan at.png) ImgOps Google

File: 1619655743995-1.png (474.45 KB, 520x520, 1:1, neslişah sultan at.png) ImgOps Google

File: 1619655743995-2.jpg (70.77 KB, 620x379, 620:379, neslişah sultan at 2.jpg) ImgOps Google

>>124582
waxxxxxxxxxx
düşünsene şöyle 4 dil bilen, kültürlü, sportmen, asil, hobileri olan bir aristokrasi-hanedanlık var ülkede
bir de şimdiki erdoğan ailesine falan bak kafayı yememek elde değil. dediğin gibi olsa en kötü ispanya ayarında bir ülkeydi. kolonyal bir devlet olsa bile en kötü malezya ayarında olurdu. tabi bunları maddi anlamda söylüyorum. müthiş bir kültürel zenginlik, birikim alanına girmiyorum bile.
>>124658
>>124660
>>124664
bunlar. büyük ihtimal reddit-discordda falan görüp kendi kendine tribe girmiş altyaş. cringeden kolum kasıldı.

8acd4 No.124676

>>124658
>verecek cevabım yok

>>124660
yaşım 28

ayrıca mevcut kamalizmin de bir sike yaramadığının farkındayım çocuğum. bu ülkeye sil baştan bir devrim şart sadece, zira yarın akp gider yerine başka bir çoban gelir

>>124675
>>124664
asıl siz beni cringe ettiniz enikler. reddit'in de amına koyayım bu arada, üyeliğim bile yok. dediğiniz sayfaları da bilmiyorum

23309 No.124677

>>124675
Kültürlü diye başımıza mı getiricez zihniyete bak sanki ülkenin tek sorunu rtenin hiç resim çizmemesi golf oynamaması…

f0d1b No.124682

>>124675
>düşünsene şöyle 4 dil bilen, kültürlü, sportmen, asil, hobileri olan bir aristokrat karını acımadan sikiyor
asıl demek istediği bu. tırrık güdülmeye muhtaçtır, bireysellik onun için yabancı ve düşman bir kavramdır; daima başında yüce melekelere sahip olan bir çobana ihtiyaç duyar, bu sayede kendini güvende ve mutlu hisseder.

2c80b No.124694

>>124682
haklısın monarkın olduğu ingiltere, bae, monaco, danimarka, lüksemburg, belçika'da bireysellik cumhuriyet olan türkiye, iran, hindistan, ıraktan falan daha kötü durumda hep çobana ihtiyaç duyuyorlar ondan.

f0d1b No.124699

File: 1619691156291.png (207.36 KB, 633x508, 633:508, ClipboardImage.png) ImgOps Google

>>124694
sen şimdi bokistan'da monark olmadığını mı iddia ediyorsun? sokakta cebinde çakı taşımana izin vermeyen ingiltere'de bireysel özgürlük olduğunu mu ima ediyorsun?

30cb4 No.124748

>>124602
>eşcinselliği yeni türkiye alameti olarak göster
>eski türkiye alameti olarak gösterdiğin adam literal olarak eşcinsel olsun

5babd No.124919

File: 1619799903049.jpg (701.23 KB, 1080x2160, 1:2, Screenshot_2021-04-30-19-2….jpg) ImgOps Google

>bulgur palas

ölürüm bokistan

95750 No.124922

>>124919
tarhana center diye bir tarihi yapı var mıdır?

c101d No.124927

>15 ülkeden bokistan'a gelecek olanlara pcr testi zorunluluğunu kaldır
>sırf bayram sonrası turist çekebilmek için kimsenin siklemediği bir sokağa çıkma yasağı koy
>hazır elim değmişken şu alkolü de yasaklayayım de, millet alkol reyonlarını perdeyle örtüp satışa devam etsin
>REİS çıkıp "kapanmada en kötü ihtimalle bokistan'dayım" desin

170a0 No.124932

File: 1619805792462.png (84.24 KB, 1023x990, 31:30, Screenshot_2021-04-24 Imag….png) ImgOps Google

yazık ülke ne hale gelmiş

83311 No.124956

>>124932
link atsana kanser hücresi

267dd No.124970


1957e No.125011


de0a1 No.125029

>>125011
çöp ithal etmek nedir gerçekten anlam veremiyorum.

29e0a No.125031

>>125029
Bu konu bir anda peydah olmadı, zaten yıllardır konuşuluyor. Hakkında belgeseller bile yapıldı. Üçüncü dünya ülkelerine çöp satılıyor, o ülkeler de çöpleri geri dönüştürüyor. Win-win durumu var yani. Bizim bok beyinliler ise hem çöp almak için para verip hem de o çöpleri geri dönüştürmeyip bir kenarda bekletiyor ya da yakıyor.

c5cbb No.125100

File: 1619956649297.webm (10.19 MB, 640x360, 16:9, bokistan hr0DwNmzlYo 43.webm) ImgOps Google

in this itt içindekiler:

e5f31 No.125119

>z kuşağı hacum

https://www.youtube.com/watch?v=fbEA1peP8B4

>bumcular ketleniyor sayıları azalıyor hajum


https://www.youtube.com/watch?v=sgsoK9doOtI

burada ve ön bahçede azınlığız, ülke nüfusunun taş çatlasın %1'ini oluşturuyoruz anlayın artık bunu.

c831f No.125160

File: 1619983395726-0.jpg (70.75 KB, 865x487, 865:487, piknik_16_9_1533538305.jpg) ImgOps Google

File: 1619983395726-1.png (851.17 KB, 810x458, 405:229, ClipboardImage.png) ImgOps Google

bir ülkede hiç mi güzel bir şey olmaz. boğulmamak elde değil. rahat rahat nefes bile alamıyorum. kafamı çeviriyorum her yerde eciş büçüş ucube yapılar, müteahhitlerin malzemeden çalıp üst üste yanyana diktiği apartmanların 30 yıllık beton duvara karşı kontrast yapan minimalist tabelaların yarattığı çirkinlik. iç tasarımı bile boğucu bembeyaz duvarlar ışıltılı pembe mobilyalardan ibaret olan süslü ahırlarda yaşıyor herkes. şu amerikan suburb'larıyla bile daşşak geçiyorlar ama onlar en azından bokistan kümeslerinden iyidir. garajı var, özgür ve ferah alanı, bahçesi vs. cennetistanın en boktan binası bile bokistanın ortalama binasından daha estetik. devlet o kadar vergi alıyor buna rağmen şu "halka hizmet" diye diktikleri millet bahçelerine bak, türbanlı "mimar"ların tasarladığı boğucu estetik kalitesi tezekle aynı, betonarme, göt göte ortada yarrak gibi duran bütün dalları budanmış ağaçlar, resmen ahır gibi, gerçi ahırın bile bir doğallığı var böyle sentetik değil. bütün hobisi apartmanında oturup maç ve haber izleyip keyif çayını içmek ve mangalda mutant tavuk kanadı yemek olan bir topluma anca bu yakışır zaten.

bu allahın belası devletin aldığı para ile sunduğu hizmetin yüzde biri bile değil. amerikada insanlar 50 yaşına kadar çalışır devlet minimum vergi aldığı için parasını biriktip emekliye ayrılır krallar gibi hayatını yaşar. bizim moruklar da ömrü boyunca devlet her boka konduğu için hiçbir birikim yapamayıp eline geçen ilk fırsatta bütün sermayesini çarçur edip 40-50 yıl günde 10 saat karın tokluğuna çalışır en sonunda da kümesinde otururken devletin verdiği 300 dolarlık emekli maaşıyla hayatta kalmaya çalışır. yaşlanınca hayatı yaşamakmış hobiymiş uğraşmış kendi işini kurmakmış bunların hiçbirisinin önemi yok bu moruklar için, anca ahırda oturayım bayramdan bayrama sevimsiz meymenetsiz cırtlak torunlarımı seveyim. bu devlet istiyor ki bu insanların hiçbir şeyi olmasın, eğlenemesinler, uğraşları olmasın, anca tavuk gibi otursunlar her boku devletten istesinler, varını yoğunu ne varsa devlete versinler, devlet de bunlara kalitesiz sağlık, kalitesiz eğitim ve kalitesiz hizmet versin. devletin ve eğitim sisteminin idealize ettiği vatandaş bu. tembel ve iq'su düşük topluma böyle bir bakıcı devlet yapısı yakışır. hiç param ve vergilerim nereye gidiyor gibi soru da sormazlar. sağılmaktan ve güdülmekten oldukça memnunlar.

794ce No.125161

File: 1619984588880.jpg (38.86 KB, 1147x876, 1147:876, 7381638191737.jpg) ImgOps Google

kek

a90fc No.125169

>>125161
amını siktiğimin ülkesinden gittiğim gün toprağı taşı öpecem

ddc02 No.125201

>>125161
clio 165 bin gardaşım herkesin bodrumda yazlığı var

50da7 No.125230

>yabancı melek gibi kızları sosyal medyada ekle uzun uzun konuşun, birbirinizden hoşlanın belki sexting yapın nudelaşın
>t virüslerini sosyal medyadan ekle, sen kimsin, neden ekledin, insan gibi cevap verince de çingene gibi küfür etmeye başlasınlar

Anasını siktiğimin kanser toprakları

4b86a No.125284

>>123559
Anon, burada neyden bahsediyor şişko ermeni?

717b9 No.125285

>>125160
düşüncelerimin büyük bir kısmını yazıya dökmüşsün ağzına sağlık kıymetli dostum. (you) vermek istedim.

21386 No.125305

Tek çözüm var k*rt ar*b s*ri ve diğer 3. dünya hayvanlarını ülkeden atmak. İbneleri yakmak - İslam'ı bitirip Tengri inancını getirmek Tayyip, Kılıçdaroğlu, Devlet Bahçeli piçini kovup gerçekten milliyetçi,zeki ve dejenere olmayan bir lider getirmek. Tekrar özümüze Orta Asya Türklerine dönmek npc kitleye söylüyorum laiklik - hoşgörü istiyorsanız siktir olun gidin Avrupistana Türkiye Türklerindir.

f399a No.125362

>>125305
bence daha iyi bir çözüm hepsinin ananı trk bayrağının üstüne yatırıp sırayla döllemesi :D

8b7f1 No.125363

>>125305

Kek, buradaki yamtar sen misin lan >>125259 ? Hasiktir git orta asya çöllerine kılıç artığı piç seni

eae5b No.125375

File: 1620154446182.jpg (117.06 KB, 780x501, 260:167, 05172017_argentina-slum_11….jpg) ImgOps Google

günlük hatırlatıcı
türkiye meksika, brezilya, arjantin, filipinler, bangladeş eşseviyesinde bir ülkedir. bu ülkeler gibi yozlaşmış bir "failed state"dir. rüşvet, nepotizm, uyuşturucu, mafya, darbe, gecekondulaşma, 0 üretim ve dünyaya katkı, devletin yaratıp desteklediği elit sınıf hepsinde ortak noktadır ve kültürleri benzemektedir. insanları tembel, yalancı ve şark kurnazıdır. ne kadar benzediklerini sadece hepsinde aynı olan boktan tv programlarına bakarak bile anlayabilirsiniz.
https://www.youtube.com/watch?v=qbgE3Qwml70

0ef38 No.125539

File: 1620310406373.jpg (59.91 KB, 880x495, 16:9, mandira-filozofu-nerede-ce….jpg) ImgOps Google


0e42e No.125783

File: 1620545838563.jpg (275.79 KB, 1108x1478, 554:739, ETisRQTU8AADrZ-.jpg) ImgOps Google

japonya'da 16 kızdan 10'u güzelken türkiye'de 16 kızdan 2'si güzeldir yanlışsam düzeltin

3e2f9 No.125784

>>125783
yanlışsın

ac597 No.125785

>>125784

aksini kanıtla sageci anon bugün 2. yapıyorsun

3588f No.125787

>>125783
sen hiç yanlış olur musun tövbe haşa anon çarpılır gideriz valla.

21bff No.125789

Türk nefretçiliği yapanlar, habbı yutun, tüccarın oyununa gelmeyin:
https://www.youtube.com/watch?v=rbJF1L97HoY

>>125783
Hepsi melek gibi

841d8 No.125807

tahta vücutlu bunlar güzel değil

f399a No.125810

>>125789
>trkofobi hajum
>barbar götümüzü sevmiyorlar hajum
zenofobi arşa çıkmalı, yalan tarih kötü bir şey değil diyen de sen değil misin? sen nasıl istiyorsan öyle yapıyor işte adamlar.

21bff No.125905

>>125810
>yalan tarih kötü bir şey değil diyen de sen değil misin?
ben kimim ve ne zaman öyle bir şey demişim?

>barbar götümüzü sevmiyorlar hajum

adam belgeleriylen açıklamış neden sevilmediğimizi, var mı aksini kanıtlayacak bir fikrin?

5f54e No.125911

File: 1620590906493.jpg (153.98 KB, 1600x900, 16:9, skw39.jpg) ImgOps Google

>>125905
>var mı aksini kanıtlayacak bir fikrin?
sizi ben de sevmiyorum. aksini neden kanıtlayayım ki?

3a366 No.125950

File: 1620640468055-0.jpg (436.92 KB, 1536x2048, 3:4, E08F3PxWEAUAOcv.jpg) ImgOps Google

File: 1620640468055-1.jpg (331.96 KB, 1536x2048, 3:4, E08F5fRWEAEwIRF.jpg) ImgOps Google

diyarbakır'daki karpuz içinde çocuk heykeli

bu çomarlar niye hala heykel konusunda zevksizliğe devam ediyor?

ff82d No.125952

File: 1620641459532.jpg (99.98 KB, 640x856, 80:107, a2u1z5EiIc9yi6ug46QzXMCSEU….jpg) ImgOps Google


82b35 No.125980

File: 1620667216136.png (2.45 MB, 2351x953, 2351:953, ClipboardImage.png) ImgOps Google

>>125950
nerdeeen nereye.

3bf33 No.125991

File: 1620677535068.jpg (26.12 KB, 739x415, 739:415, 20210510_231127.jpg) ImgOps Google

AHAHAHAHAHAHAHAHAAHAHAHAHA

485da No.125993

>>125991
when alev alev anon?

8b8a3 No.126010

File: 1620723665113.jpg (1.08 MB, 2100x1400, 3:2, Microrayon_w_drying_laundr….jpg) ImgOps Google

sizce bu resim hangi şehirden?

1b3e6 No.126011

File: 1620723863137.jpg (287.09 KB, 1200x805, 240:161, 1200px-Paldiski_2006-2.jpg) ImgOps Google

>>126010
Paldiski, Estonya'nın Harju iline bağlı belediyelerden biridir. Yüzölçümü 60.17 km² olan yerleşim biriminin nüfusu 4,224'tür. Kilometrekareye yaklaşık 70,2 kişi düşer.

44ee8 No.126058

grand prix ket
şampiyonlar ligi finali ket

41984 No.126129

>>125305
>özümüze, orta asya türklerine dönmek
keeeeeeeeeeek
türk degilsin. arap, kürd, yunan karışımı bir mutt sın

d4cbf No.126387

File: 1620941437233.jpg (361.52 KB, 1300x1300, 1:1, iq-europe.jpg) ImgOps Google

>literally avrupa asya amerikadaki en düşük ortalama iq
>üstüne muhafazakar toplum yapısı ve islamı ekle

Yemin ederim maymunistan, afrikada doğmak daha mantıklı en kötü yerinde fakir doğsan bile mazot çekip tavşan gibi sikişir erken yaşta da geberip giderdim

db3cd No.126421

>>126387
brezilya bitti afrika mı başladı spamcı?

2ed6a No.126482

File: 1621012990717.png (1.84 MB, 1366x768, 683:384, ClipboardImage.png) ImgOps Google

Tamam hadi ekonomi leş olur insanlar çiğ köfte yemekten gelişemez anlarım da, bir ülkede hiç mi güzel bir şey olmaz. Hiç mi güzel adeti, gelenek göreneği olmaz, plastik sandalyede sokak düğününden öte gitmiyor hiçbir şey, ülkenin genelinde insanı boğan yazısız bokistan kuralları var, bu hava hepimizi strese sokuyor zaten.

En azından doğası güzel olur ki en rare bölgelerde bile pet şişe yığınına dönüşmüş. Her güzel yeri şahinden ankara havası oynatan böcekler istila etmiş, Güzel bir şey göremiyorum.

Tamam o zaman seks yapmak kolay olur en azından, afrikadaki gibi. Aidsten gidersin ama en azından mutlu bir hayat geçirirsin seks yaparsın, doğa cennet gibi, kendine has kültürü var, insanları barbar değil, güzel şeyler hissedebiliyorsun.

Bayrağı bile osmanlı çorabı mı kokar bir ülkenin? Hiç iyi bi şey olmaz mı bir ülkede? Şaka gibi gerçekten, insanları leş ve barbar, hoşgörü zeka hak getire. Sokaktaki manzara nazar boncuklu beton yığınlarından ibaret, yaşıyorum ulaaaan diye bağırabileceğin kendini insan gibi hissedebileceğin bir yer bile yok.

Et bile alırken 2 yıl garantiyle alacak durumdasın zaten bunun üstüne baskı ve stres, kötü aptal ve zevksiz insanlar, leş yapılaşmayı, islamı, camiileri eklediğimde boğulacak gibi oluyorum.

2ed6a No.126486

File: 1621015030991.png (5.9 MB, 2560x1440, 16:9, ClipboardImage.png) ImgOps Google

türkler neden çalışacakları zaman işi taşağa verip eğlenecekleri zaman da ciddi kesiliyorlar? yok rakı şöyle içilmez böyle içilir adabı vardır falan. alt tarafı içip eğleneceksin ortamı niye geriyorsun. plebbitte de bir türko bokposting subuna bakayım dedim 50 tane ciddi kural döşemişler. ciddi olacakları zaman da dalga geçerler sürekli. ne çalışmasını, ne eğlenmesini bilmeyen, her şeye zıt ilerleyen iğrenç bir millet.

f68df No.126566

>>126486
Bu kadar kural saçma askeriye sisteminde bile yok boş boş yazılar işte al içkini evinde uslu uslu iç

00d51 No.126591

tuttuğu takım şampiyon oldu diye akşamın bu saatinde insanların rahatını bozmayı kendine hak gören neandertaller doldu yine sokağa. bi de sözde tam kapanma var. 4-5 tane spor mafyası zengin oldu diye boğazı yırtılana kadar bağırıp kornayla geziyo adamlar. sorsak kendisi kıt kanaat geçiniyodur. şampiyonluk primi almış sporcular bu kadar sevinmiyodur amına koyim, şimdi hepsi evinde oturmuş dinleniyodur. allax'ım sinir hastası etmeden kurtar beni şu lağım diyarından artık.

853fe No.126592

>>126591
dünyanın her yerinde var bununla anlaş

05a50 No.126593

>>126592
nerede var allax aşkına amerikada nfl i kazanan veya nbade bir takım kazanınca herhangi bir eyaletin herhangi bir şehrinde sokaklarda kornalar basarak bağıranların olduğu bir video at bakayım bana bir.

93a24 No.126598

File: 1621109777782.jpg (172.16 KB, 656x400, 41:25, barbaros sansal.jpg) ImgOps Google

>>126592
daha geçen belçika'da kornalı konvoy yapan eşşek türkolara ceza kesildi bi de üstüne utanmadan ırkçı polis falan diye ağladılar. google'da arat bulursun haberi. bilip bilmeden konuşuyosunuz amına koyim sanki biz hiç kutlama olmasın dedik, şu yukardaki anonun dediği gibi bi tane örnek versene batıdan. futbolun başkenti ingiltere'de bile bu yamyamlık yok. size laf anlatmaktan bıktım übş'nin dediği gibi bokunuzda boğulun. Ellax gavatı izin verirse Ekim'de başvurumu yapıp DV-2023'le gidip Tunay'ın bi bardak çayını içeceğim.

70077 No.126625

File: 1621152976608.png (79.81 KB, 933x349, 933:349, 3WMag6h.png) ImgOps Google

revizyon şovu

35209 No.126732

File: 1621193758946.jpg (77.5 KB, 1369x518, 37:14, Capture.JPG) ImgOps Google




[Return][Go to top] [Catalog] [Post a Reply]
[ [ < ] [ b / g / s / v ] [ Kurallar / Stats ] ]